423 realizations of a product of sums expression a or and b or and with extra

Báo cáo y học: "A global view of gene expression in lithium and zinc treated sea urchin embryos: new components of gene regulatory network" pot

... References Databases and database management Development and maintenance of the sea urchin web application was done on a dual core 64 bit computer running a Linux operating system using an Apache webserver ... embryos (pink bars) Data are presented in a logarithmic style Bars above indicate upregulation and bars below indicate downregulation The numbers given on top or bottom of bars are the number of ... made in rabbits and obtained from Sigma (Munich, Bavaria, Germany) (product number S5545) As secondary antibodies we used anti-Rabbit (IgG)-Alexa594 (red) from Molecular Probes (product number...

Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt

Danh mục: Báo cáo khoa học

... and oxidation 75 Tabner BJ, Turnbull S, El-Agnaf OM & Allsop D (2002) Formation of hydrogen peroxide and hydroxyl radicals from A( beta) and alpha-synuclein as a possible mechanism of cell death ... lysates was then analyzed according to the manufacturer’s instructions Absorbance was read on a Dynatech MR5000 microplate reader (Dynatech, Chantilly, VA, USA) at 540 nm with a reference wavelength ... Japan) Images were recorded with a MegaviewII numeric camera, and analysis software (Soft Imaging System GmbH, Munster, Germany) ¨ was used to analyze the images Determination of intracellular...

Báo cáo y học: " Upregulation of pirin expression by chronic cigarette smoking is associated with bronchial epithelial cell apoptosis" ppsx

Danh mục: Báo cáo khoa học

... TCAAGACCTGCTCTTCCGCT, with probe AACCTGGAAATCAAAGATTGGGAACTAGTGGA The endogenous and adenovirus-produced pirin primers were: forward CACGCTGAGATGCCTTGCT and reverse ACCATCTTCTCTGAGCTCCTCAA with probe CAGCCCATGGCCTACAACTGTGGGTTATA ... [44] 1All up-regulated genes were evaluated for an association with apoptosis by reviewing published information about each gene available in public databases Genes that had experimental evidence ... AdPirin (pu) Evaluation of BEAS- 2B bronchial epithelial cells exposed to varying concentrations of cigarette smoke extract, AdPirin and Figure AdNull Evaluation of BEAS- 2B bronchial epithelial...

Báo cáo y học: "Macrophage migration inhibitory factor enhances osteoclastogenesis through upregulation of RANKL expression from fibroblast-like synoviocytes in patients with rheumatoid arthriti" doc

Danh mục: Báo cáo khoa học

... osteoprotegerin and soluble receptor activator of nuclear factor kappa B ligand in serum of rheumatoid arthritis patients and their normalization after anti-tumor necrosis factor alpha treatment Arthritis ... rheumatoid arthritis Arthritis Res Ther 2006, 8:R132 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases ... MAPK, STAT3, IBa, and c-Jun in RA synovial fibroblasts The activated forms of Akt, p38 MAPK, STAT3, IBa, and c-Jun were detected by western blot analysis in RA synovial fibroblasts stimulated...

Báo cáo sinh học: " Bootstrapping of gene-expression data improves and controls the false discovery rate of diﬀerentially expressed genes" ppsx

Danh mục: Báo cáo khoa học

... publicly available data sets: the leukemia data of Golub et al [6], and the apoAI knockout mice data of Callow et al [4] METHODS 2.1 Leukemia data The advantage of the leukemia data of Golub ... In order to obtain again a test and a control data set, the data were arbitrarily split into two sub sets called: DATA1 and DATA2 Each sub set consisted of of the knockout mouse arrays and of ... the apoAI data, TRAIN is replaced by DATA1 and INDEPEND by DATA2 False discovery rates in microarray data 195 2.4 Methods of analyses The t-test statistic is obtained by applying equation (1) and...

Báo cáo y học: "Nonrandom divergence of gene expression following gene and genome duplications in the flowering plant Arabidopsis thaliana" doc

Danh mục: Báo cáo khoa học

... following additional data are available with the online version of this paper Additional data file is a description of dataset Additional data file is a description of dataset Additional data file ... and duplicated genes of subclasses according to Arabidopsis thaliana of duplication (see Materials The duplicated genes of Arabidopsis thaliana were divided into six different subclasses according ... regulatory genes in Arabidopsis, Duarte et al [33] performed an analysis of variance (ANOVA) and showed that 85% of the 280 paralogs exhibit a significant gene by organ interaction effect, indicative...

Báo cáo y học: "Modulation of gene expression in drug resistant Leishmania is associated with gene amplification, gene deletion and chromosome aneuploidy" ppsx

Danh mục: Báo cáo khoa học

... microarray expression data (grey bars) are compared to qRT-PCR data (black bars) for (a) L infantum MTX20.5 and (b) L major MTX60.4 The microarray data are the average of four biological replicates ... Peacock CS, Worthey EA, Murphy L, Aggarwal G, Berriman M, Sisk E, Rajandream MA, Adlem E, Aert R, Anupama A, Apostolou Z, Attipoe P, Bason N, Bauser C, Beck A, Beverley SM, Bianchettin G, Borzym ... authors read and approved the final manuscript 10 11 12 13 Additional data files The following additional data are available with the online version of this paper Additional data file contains Table...

Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

Danh mục: Báo cáo khoa học

... acid or an amino-alcohol [11] In contrast, MAAs are UV absorbing metabolites of algae that contain an aminocyclohexenimine ring system, with UV absorption maxima between 310 and 360 nm To date, ... cyanobacteria Cells with high concentrations of MAAs are approximately 25% more resistant to UV radiation centered at 320 nm than those with no or low concentrations of MAAs [25] MAAs have been ... defence mechanisms developed by ancient photosynthetic organisms such as lichens, fungi, cyanobacteria, corals and other marine organisms are much more advanced than those of mammals because photosynthetic...

Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

Danh mục: Y học thưởng thức

... sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically synthesized ... Spinal cord RNA extraction and real time PCR Total RNA was extracted from L4–L5 spinal cord tissues Extracted RNA was pretreated with DNaseⅠ at 37 for 30 minutes before reverse transcription reaction ... reagent (Neuromics, Edina, MN, USA) was administered intrathecally once daily for days, starting from day before CCI surgery Evaluation of tactile allodynia and thermal hyperalgesia The paw withdrawal...

Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula ofﬁcinalis pptx

Danh mục: Báo cáo khoa học

... demonstrate that calendate production is initiated by an energetically difﬁcult and hence isotopically sensitive hydrogen abstraction at C11 and completed by a second facile and kinetically unimportant ... strain DTY-1 0a2 and Michele Loewen and Robert Sasata for reviewing the manuscript REFERENCES Shanklin, J & Cahoon, E .B (1998) Desaturation and related modiﬁcations of fatty acids Annu Rev Plant ... recently, it was suggested that C8 might be the site of initial oxidation for this process based on a comparison with the putative site of initial attack catalyzed by a soluble plant D9 desaturase [37]...

Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx

Danh mục: Báo cáo khoa học

... exchange method described by Orr & Blanchard to be particularly reliable and robust for our purposes [6] Inclusion of AMP as an internal standard increased precision and accuracy, and replacement ... were withdrawn, AMP was added as internal standard, and samples were analyzed by ion exchange chromatography as described above The amount of NADPO was determined on the basis of peak integration ... mm ammonium formate, and chromatographed by a modiﬁcation of the high-performance ion exchange proce¨ dure described in Orr & Blanchard [6] Using an AKTA FPLC apparatus (GE Healthcare), samples...

Báo cáo khoa học: The crystal structure of Thermoactinomyces vulgaris R-47 a-amylase II (TVA II) complexed with transglycosylated product potx

Danh mục: Báo cáo khoa học

... form a complex between TVA II and a pullulan model substrate by using partial hydrolyates of pullulan and an inactive TVA II mutant, D325N A hexasaccharide containing two panose units, 43 -a- panosylpanose ... 120 lL) was added to 480 lL of various concentrated substrates (soluble starch was purchased from Merck, Germany; pullulan was obtained from Hayashibara Biochemical Laboratories, Japan) in 100 ... Shimada, J., Handa, S., Takada, T., Umeyama, H & Okada, S (1996) Controlling substrate preference and transglycosylation activity of neopullulanase by manipulating steric constraint and hydrophobicity...

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Danh mục: Hóa học - Dầu khí

... genome by PCR into pBluescript II KS+ (Stratagene) 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA ... (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for ... generated by PCR from pCR2.1 (Invitrogen) using the following primers: Materials and methods and 5'-CGCATCCGTCGGGAGGCCACAGAAACAAAACCGGGTTTATTTCCTAAAAT Cells and viruses Vero, rabbit skin, and...

Báo cáo y học: "The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products" potx

Danh mục: Báo cáo khoa học

... the outer leaflet of the plasma membrane, which is reversible if stimulation is brief (and thus independent of cell death) As PS and associated proteins are major targets of autoantibodies in SLE ... further adding to the cycle of ATP release and destruction Release of autoantigens within P2X7-stimulated aponecrotic debris may also contribute to a breakdown in self-tolerance and initiation of autoimmunity ... Dickinson) or Flowjo (Tree Star, Ashland, OR, USA) software Baseline fluorescence was established for approximately prior to addition of 150 µM (unless otherwise stated) 2'-3'-O-(4benzoylbenzoyl)-adenosine...

Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps

Danh mục: Báo cáo khoa học

... cardiovascular and neurological examinations were unremarkable Initial laboratory investigations (Table 1) revealed anemia, leukopenia, elevated blood urea nitrogen and elevated serum creatinine ... negative On day four of admission, she developed acute inflammatory arthritis of the elbows and knees A serological workup revealed high anti-nuclear antibody, anti-double-stranded DNA antibody ... the association between type RTA and SLE in patients with high SLEDAI scores They found that the degree of hyperkalemia was correlated with a high SLEDAI score and that these patients had a poor...

Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

Danh mục: Báo cáo khoa học

... Ministry of University and Scientific Research and the Fondazione Cariparma (Cassa di Risparmio di Parma, Italy) for funding contributions to the project Author details Department of Human Anatomy and ... University of Padova, Italy Department of Neuroscience, University of Padova, Italy 3Department of Pharmaceutical Sciences, University of Parma, Italy 4Department of Animal Health, University of Parma, ... isolated from the spinal cord of a cow with astasia Archives of virology 2000, 145(11):2363-2370 Redaelli M, Cavaggioni A, Mucignat-Caretta C, Cavirani S, Caretta A, Donofrio G: Transduction of...

Báo cáo y học: " In vitro activities of novel 4-HPR derivatives on a panel of rhabdoid and other tumor cell lines" docx

Danh mục: Báo cáo khoa học

... derivatives of 4-HPR (1 1a, 11c, and 11d) may be more stable and may 13 have the potential to traverse the blood-brain barrier because of the substitution of the alkene backbone with a lipophilic ... was used to elaborate data Analysis of cell death was performed by gating for the sub-G1 population during FACS as previously described [7] Statistical analysis Statistical analysis of the data ... stability and bioavailability in vivo [27, 28] In particular, the peptidomimetic derivatives are more lipophilic, which increases bioavailability and possibly facilitates crossing the bloodbrain-barrier...

The Art of Public Speaking cylinder, piston, water, and fire, is the steam−engine in its most elementary form. For a steam−engine may be defined as an apparatus for doing work by means of heat applied to water; and since raising such a weight as the pisto

Danh mục: Kỹ năng thuyết trình

...

5
1,290
3

Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"

Danh mục: Y học thưởng thức

... = bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were ... groups One-way analysis of variance was used for comparison of means among groups Initially, categories with or without Sarapin in each group were analyzed by comparing them to each other Subsequently, ... if there was 80% pain relief of at least hours for lidocaine and hours for bupivacaine and greater than the duration of relief with lidocaine, and the ability to perform multiple maneuvers which...

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

Danh mục: Y học thưởng thức

... commercially available PG and TA 3.6 Correlation coefficients We analyzed the correlation of levels of antipeptidoglycan and teichoic acid antibodies in sera from patients with deep-seated and superficial ... Figure Correlation plots of antibodies to PG and TA Antibody levels against peptidoglycan and teichoic acid in patients with superficial (A) and those with deep-seated (B) as measured by ELISA were ... deep-seated (A) and superficial staphylococcal infection (B) The crude protein extracts were separated by SDS–PAGE and stained with Coomassie blue Lane M; molecular weight marker; Lane A; standard...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25

423 realizations of a product of sums expression a or and b or and with extra inver

423 realizations of a product of sums expression a or and b or and with extra inver